In Vitro Mutagenesisįigure 1: FREAC-1 and FREAC-2 are identical in the DNA binding domains and in the COOH termini. Both PCR products were digested with XhoI and HindIII and cloned between the corresponding sites in pGL2-Basic (Promega) to create CC10-luc and SPB-luc. The human surfactant protein B (SPB) gene promoter (−236 to +61) was amplified from human, genomic DNA with the primers GAGACTCGAGTTGAGAGCCCCTGGTTGGAGGAAG and AGAGAAGCTTCAGCCACTGCAGCAGGTGTGACT. The rat Clara cell 10-kDa protein (CC10) gene promoter (−323 to +56) was PCR amplified from rat genomic DNA with the primers GAGACTCGAGTTGGCAAGTCTACAATTGCTTCCC and AGAGAAGCTTGGGCTGTCTGTAGATGTGG.
Four tandem copies of a double-stranded oligonucleotide containing a high affinity FREAC binding site (upper, GATCCAACGTAAACAATCCGA lower, GATCTCGGATTGTTTACGTTG) were ligated into the BglII site of apoB-luc to create 4×FREAC-luc.
The apoB-luc reporter was created by cloning the minimal apoB promoter (−45 to +121) and the UMS transcriptional terminator from pBPcat-45 (Carlsson and Bjursell, 1989) into pGL2-Basic (Promega) and insertion of a BglII linker into the SphI site between UMS and the apoB promoter. The nude mice mutant, which causes defective development of the thymus and hair follicles, results from deletions within the forkhead gene whn (Nehls et al., 1994). Targeted disruption of the mouse genes for HNF3β (Ang and Rossant, 1994 Weinstein et al., 1994) and BF-1 (Xuan et al., 1995) cause severe malformation of the central nervous system. Developmental mutants in Drosophila (Grossniklaus et al., 1992 Häcker et al., 1992), Caenorhabditis elegans (Miller et al., 1993), and zebrafish (Strähle et al., 1993) have been shown to be caused by mutations in genes that contain the forkhead homology, and several lines of evidence prove the importance of this gene family for the embryonic development of mammals as well. Many forkhead genes have been isolated based on their homology to the first identified members of this family: forkhead from Drosophila (Weigel et al., 1989 Weigel and Jäckle, 1990) and HNF3α from rat (Lai et al., 1990) little is known about their function (Bork et al., 1992 Häcker et al., 1992 Clevidence et al., 1993 Kaestner et al., 1993 Pierrou et al., 1994). Sequences flanking the core on both sides and minor variations within the core provide the specificity unique to each forkhead protein. Selection of binding sites from random sequence oligonucleotides has shown that a number of forkhead proteins share the requirement for a RTAAAYA core sequence to bind with high affinity to DNA (Overdier et al., 1994 Pierrou et al., 1994 Kaufmann et al., 1995). Binding of the forkhead proteins FREAC-3 and FREAC-4 to their cognate sites results in bending of the DNA at an angle of 80-90° (Pierrou et al., 1994). The forkhead domain binds DNA as a monomer and contains two loops (or wings) on the COOH-terminal side of the helix-turn-helix, which has given the structure the name “the winged helix” (Brennan, 1993 Clark et al., 1993 Lai et al., 1993). X-ray crystallography of the forkhead domain from HNF3γ revealed a three-dimensional structure that is a variation on the helix-turn-helix motif (Clark et al., 1993). The forkhead motif is a 100-amino acid DNA binding domain that defines a family of transcription factors found in metazoans and Saccharomyces. Efficient activation of CC10 by FREAC-1 is shown to be specific for a lung cell line with Clara cell characteristics (H441) and to involve a region of the FREAC-1 protein unable to activate in other cell types. While an SPB promoter construct could be transactivated by both FREAC-1 and FREAC-2, CC10 was only activated by FREAC-1.
DNaseI footprinting verified that FREAC proteins bind to the predicted sites in the CC10 and SPB promoters. We show that the promoters of genes for lung-specific proteins such as pulmonary surfactant proteins A, B, and C (SPA, SPB, and SPC) and the Clara cell 10-kDa protein (CC10) contain potential binding sites for FREAC-1 and FREAC-2. Expression of FREAC-1 and FREAC-2 is restricted to lung and placenta. Cotransfections with a reporter carrying FREAC binding sites showed that both proteins are transcriptional activators, and deletions located the activation domains to the COOH-terminal side of the forkhead domains. FREAC-1 and −2 are encoded by distinct genes, are almost identical within their DNA binding domains and in the COOH termini, but are otherwise divergent.
Freac covers Activator#
We describe the cDNA sequences for two human transcription factors, Forkhead RElated ACtivator (FREAC)-1 and −2, that belong to the forkhead family of eukaryotic DNA binding proteins.
0 kommentar(er)
